View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_31 (Length: 418)
Name: NF1863_low_31
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 2e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 154 - 406
Target Start/End: Complemental strand, 46587283 - 46587022
Alignment:
| Q |
154 |
tggattaaggcttgaagttccgcaccattaattaaatatgctttatagtttatacaattgacatctagtatttagtaa-----------gggatcaaaca |
242 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
46587283 |
tggagtaaggcttgaagttccgcaccattaattaaatatgctttatagtttatacaattgacatcta---tttagtaaacgatagtgtagggatcaaaca |
46587187 |
T |
|
| Q |
243 |
atttttatccaaatttattagactaggannnnnnnn-aataacacaccggttaatgttggaattattagataataagattgaagttatgttatgagtcct |
341 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46587186 |
atttttatccaaatttattagactaggatttttttttaataacacaccggttaatgttggaattattagataataagattgaagttatgtcatgagtcct |
46587087 |
T |
|
| Q |
342 |
ttaagttttaagttagtagagcccattctcttgtaacattttgacacatcataccatttgatatt |
406 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587086 |
ttaaattttaagttagtagagcccattctcttgtaacattttgacacatcataccatttgatatt |
46587022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University