View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_34 (Length: 409)
Name: NF1863_low_34
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 82 - 392
Target Start/End: Original strand, 49040886 - 49041191
Alignment:
| Q |
82 |
attaatgatgtactaactcacaagtcacaagtgctaataaaataatacacctttttt--ctcgttacattgaattaataacaacaagaaaaggtaacaat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || | |
|
|
| T |
49040886 |
attaatgatgtactaactcacaagtcacaagtgctaataaaataatacaccttttttttctcgttacattgaattaataacaacaagaaaa--tagc--- |
49040980 |
T |
 |
| Q |
180 |
cttgctttacaaatttt-aagaagcaacagaaacagggacactaacgggatacttatgaacagagtcatcccaggggttgccccgccaatccccaacgac |
278 |
Q |
| |
|
| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040981 |
---gttttagaaatttttaagaagcaacagaaacagggacactaacgggatacttatgaacagagtcatcccaggggttgccccgccaatccccaacgac |
49041077 |
T |
 |
| Q |
279 |
gggcaagtcgcgcacggccttccacacggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaaccctgcccttt |
378 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49041078 |
gggcaagtcacgcacggccttccacacggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaacccggcccttt |
49041177 |
T |
 |
| Q |
379 |
gcctcagtataagc |
392 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49041178 |
gcctcagtataagc |
49041191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 383
Target Start/End: Complemental strand, 49040316 - 49040232
Alignment:
| Q |
299 |
tccacacggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaaccctgccctttgcctc |
383 |
Q |
| |
|
|||| ||||| |||||||| |||||||| | |||||||||||||||||| |||| |||||| |||| ||| || ||||| ||||| |
|
|
| T |
49040316 |
tccatacggcactgttacatttaaaacctgccccaaatgcaatctgccacaccctatccccctttgaaactctacccttggcctc |
49040232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University