View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_48 (Length: 354)
Name: NF1863_low_48
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 42696227 - 42695892
Alignment:
| Q |
1 |
gaaaatggtcatgatgatgatgggatgaagaagaacgtggtgagagctttgccattttttaaactattgagctatgctgattatgtggactggattctta |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42696227 |
gaaaatggtcatgatgatgatgagatgaagaagaacgtggtgagagctttgccattttttaaactattgagctatgctgattatgtggattggattctta |
42696128 |
T |
|
| Q |
101 |
tgggtttgggaacattaggttcgattgtgcatggcatggcacttcctgttggttatttgttgttaggaaaagctcttaatgcttttggaaacaatattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42696127 |
tgggtttgggaacattaggttcgattgtgcatggcatggcacttcctgttggttatttgttgttaggaaaagctcttaatgcttttggaaacaatattaa |
42696028 |
T |
|
| Q |
201 |
taacattgatgctatggttcctgctcttaaacaggtacctactaatactataataacacatttttatacaaggttctagatgttaccatgcacaacaata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42696027 |
taacattgatgctatggttcctgctcttaaaaaggtacctactgatactataataacacatttttatacaaggttctagatgttaccatgcacaacaata |
42695928 |
T |
|
| Q |
301 |
tgttatactagtttcaaacgttgcaatatatgcacc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695927 |
tgttatactagtttcaaacgttgcaatatatgcacc |
42695892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University