View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_51 (Length: 341)
Name: NF1863_low_51
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 9 - 326
Target Start/End: Complemental strand, 4536630 - 4536313
Alignment:
| Q |
9 |
ataatactagtaatagtgtattgttttaatttagtgctgaacttgaatttcttagataataaggtattcaaattccaattttgtaggtggaaaaaacgta |
108 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4536630 |
ataacactagtaatagtctattgttttaatttagtgctgaacttgaatttcttagataataaggtattcaaattccaattttgtaggtggaaaaaacgta |
4536531 |
T |
 |
| Q |
109 |
gtcgaaagggaagataccactaaaggcgtttgtcaaacagattatctaacggagtttatttattggcaaagtcggagagggtctaataattttcctgcaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
4536530 |
gtcgaaagggaagataccactaaaggcgtttgtcaaacagattatctaacggagtttatttataggcaaagtcggagagggtctaataatttctctgcaa |
4536431 |
T |
 |
| Q |
209 |
acaaatgggtctaaatatgaatccaagttttagctacaaaacttgtaccacaaacaaaatcgaacaactcgcattttgactctttctacttctgagcaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4536430 |
acaaatgggtctaaatatgaatccaagttttagctacaaaacttgtaccacaaacaaaatcggacaactcgcattttgactctttctacttctgagcaaa |
4536331 |
T |
 |
| Q |
309 |
tttatcgaagtcaaaatt |
326 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
4536330 |
tttatcaaagtcaaaatt |
4536313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University