View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1863_low_53 (Length: 323)

Name: NF1863_low_53
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1863_low_53
NF1863_low_53
[»] chr2 (1 HSPs)
chr2 (11-304)||(43815064-43815351)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 304
Target Start/End: Complemental strand, 43815351 - 43815064
Alignment:
Q  11 acatcatcagtcaatacattcggcgtattcgtaacccaaattcctttctctctgcaattcttcagatcaattttatcaaatccaacgctgtaagtagaca 110  Q
    |||||||||||||| |||| ||||||||||||||| ||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| |    
T  43815351 acatcatcagtcaacacatccggcgtattcgtaacacaaatccctttctccctgcatttcttcagatcaattttatcaaatccaacactgtaagtagaaa 43815252  T
Q  111 caatctcaagattaggaagagaatcgattgtgtttgcgtcggctccgattttggtgctgcaaaccaatgcgcgaatggaatttgcgtgggtttcagacaa 210  Q
    ||||||||||||||||||||||||||||||| ||||| || ||||||||||||||| ||||||||||||| ||||| ||||||||||||||||| || ||    
T  43815251 caatctcaagattaggaagagaatcgattgtatttgcatccgctccgattttggtgttgcaaaccaatgcacgaattgaatttgcgtgggtttctgagaa 43815152  T
Q  211 ggattggaaggaaggatagttccagagtttgaagaggttgaaacggttggaattggaaagttgttcttcgaggtttgtgttcattggatatgtc 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||      |||| ||||||||||||||||||||||||||||| ||||||    
T  43815151 ggattggaaggaaggatagttccagagtttgaagaggttgaaacggt------tggagagttgttcttcgaggtttgtgttcattgggtatgtc 43815064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University