View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_54 (Length: 323)
Name: NF1863_low_54
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 13890312 - 13890093
Alignment:
| Q |
20 |
cattatcatatcccacaggttaccactttacaccaacatggttctaaattgcggttgcagttacactacaaaccataatattacaaagtnnnnnnntgcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13890312 |
cattatcatatcccacaggttaccactttacaccaacatggttctaaattgcggttgcagttacactacaaaccataatattacaa--caaaaaaatgcg |
13890215 |
T |
 |
| Q |
120 |
ggcaaataataccgcaattgtagtttcaacatcgttgcagagacctctaaaacttctatattacaaccgcaatttagaactatgagcaacactatttctt |
219 |
Q |
| |
|
|||||||| ||| | |||| ||||||||| | |||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||| || |
|
|
| T |
13890214 |
ggcaaatagtacagtaattatagtttcaatgttgttgcaaagacctctaaaacttttatattacgaccacaatttagaactatgagcaacactatttttt |
13890115 |
T |
 |
| Q |
220 |
atcttaattttcttgtgtaaaa |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13890114 |
atcttaattttcttgtgtaaaa |
13890093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 14030437 - 14030218
Alignment:
| Q |
20 |
cattatcatatcccacaggttaccactttacaccaacatggttctaaattgcggttgcagttacactacaaaccataatattacaaagtnnnnnnntgcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14030437 |
cattatcatatcccacaggttaccactttacaccaacatggttctaaattgcggttgcagttacactacaaaccataatattacaa--caaaaaaatgcg |
14030340 |
T |
 |
| Q |
120 |
ggcaaataataccgcaattgtagtttcaacatcgttgcagagacctctaaaacttctatattacaaccgcaatttagaactatgagcaacactatttctt |
219 |
Q |
| |
|
|||||||| ||| | |||| ||||||||| | |||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||| || |
|
|
| T |
14030339 |
ggcaaatagtacagtaattatagtttcaatgttgttgcaaagacctctaaaacttttatattacgaccacaatttagaactatgagcaacactatttttt |
14030240 |
T |
 |
| Q |
220 |
atcttaattttcttgtgtaaaa |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14030239 |
atcttaattttcttgtgtaaaa |
14030218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 304
Target Start/End: Complemental strand, 13890061 - 13890032
Alignment:
| Q |
275 |
gtttattgtttcattgcagatagatcacaa |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13890061 |
gtttattgtttcattgcagatagatcacaa |
13890032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 304
Target Start/End: Complemental strand, 14030186 - 14030157
Alignment:
| Q |
275 |
gtttattgtttcattgcagatagatcacaa |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14030186 |
gtttattgtttcattgcagatagatcacaa |
14030157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 13909635 - 13909671
Alignment:
| Q |
55 |
acatggttctaaattgcggttgcagttacactacaaa |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
13909635 |
acatggttctaagttgcggttgcagttatactacaaa |
13909671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University