View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_56 (Length: 320)
Name: NF1863_low_56
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 305
Target Start/End: Original strand, 24260093 - 24260375
Alignment:
| Q |
11 |
atgaagattttgtttggtcaattgaggttccactgtctggaaaattcatcattgatgttgatttccttgatttgaagattgcaggcccagatgtatatgc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24260093 |
atgaagattttgtttggtcaattgaggttccactgtctggaaaattcatcattgatgttgatttccttgatttgaagattgcaggcccagatgtatatgc |
24260192 |
T |
 |
| Q |
111 |
tcaagacttatcttttattattattgattttctatgatattcactgcaaatgataatcatttagatacaattagaatgtgacagtatagctaaaatcaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24260193 |
tcaagacttatcttttattattattgattttctattatattcactgcaaatgataatcatttagatacaattagaatgtgacagtatagctaaaatcaat |
24260292 |
T |
 |
| Q |
211 |
tttggggtagtaattggatttagtaatccccttttataatcatgagcatttaattaatt-ctatgttcataatcaccaatgatgaatcagaatgat |
305 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
24260293 |
tttgggg-------------tagtaatccccttttataatcatgagcatttaattaattcctttgttcataatcaccaatgatgaatcagaatgat |
24260375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University