View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_62 (Length: 305)
Name: NF1863_low_62
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 177 - 288
Target Start/End: Original strand, 34013905 - 34014016
Alignment:
| Q |
177 |
cttgcatcttagcatatagttttggtttgagttttgaatttatgctattaatactattaactgtgaaatgaaaacaatcatatggatatttaaatttcct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34013905 |
cttgcatcttagcatatagttttggtttgagttttgaatttatgctattaatactattaaccgtgaaatgaaaacaatcatatggatatttaaatttcct |
34014004 |
T |
 |
| Q |
277 |
ttctatcttcct |
288 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34014005 |
ttctatcttcct |
34014016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 117
Target Start/End: Original strand, 34013742 - 34013845
Alignment:
| Q |
10 |
attattctagtggatctaaaataaaagaataaaaacaagnnnnnnnnnaggggnnnnnnnctttagaaaaattaaagtcgaagattcggatctatgcttc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34013742 |
attattctagtggatctaaaataaaagaataaaaacaagtttttttttaggggaaaaaaactttagaaa----aaagtcgaagattcggatctatgcttc |
34013837 |
T |
 |
| Q |
110 |
ttaattct |
117 |
Q |
| |
|
|||||||| |
|
|
| T |
34013838 |
ttaattct |
34013845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University