View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_67 (Length: 291)
Name: NF1863_low_67
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 41333324 - 41333603
Alignment:
| Q |
1 |
attaaaatgtaaaccagtccaactaatagttgcttctattgagtattgaattcaaatagggaacaatggcacactagatggacaaggtgaactgtggtgg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41333324 |
attaaaatataaaccagtccaactaatatttgcttctattgattattgaattcaaatagggaacaatggcacactagatggacaaggtgaactgtggtgg |
41333423 |
T |
|
| Q |
101 |
caaaagtttcacaaggggaagctcacttatactaggccttacctgattgaaatcatgtactcggataatatacagatatccaatcttactttggttaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41333424 |
caaaagtttcacaaggggaagctcacttatactaggccttacctgattgaaatcatgtactcggataatatacagatatccaatcttactttggttaatt |
41333523 |
T |
|
| Q |
201 |
ctccatcctggaatgtccatcctgtttacagcaggttcatctttttctctttgcaatgtctattatcaatctactatatt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41333524 |
ctccatcctggaatgtccatcctgtttacagcaggttcatctttttctctttgcaatgtctattatcaatctactatatt |
41333603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 195 - 236
Target Start/End: Original strand, 29764837 - 29764878
Alignment:
| Q |
195 |
ttaattctccatcctggaatgtccatcctgtttacagcaggt |
236 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
29764837 |
ttaattctccatcatggaatgttcatcctgtttacagcaggt |
29764878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 131 - 237
Target Start/End: Complemental strand, 45075774 - 45075668
Alignment:
| Q |
131 |
actaggccttacctgattgaaatcatgtactcggataatatacagatatccaatcttactttggttaattctccatcctggaatgtccatcctgtttaca |
230 |
Q |
| |
|
|||||||| ||| ||||||| || ||||| || ||| | || || ||||||||||| |||||| | ||||| || || ||| ||||||||| ||||||| |
|
|
| T |
45075774 |
actaggccatacatgattgagattatgtattctgatcaaatccaaatatccaatctcactttgatcaattccccttcttggtttgtccatccagtttaca |
45075675 |
T |
|
| Q |
231 |
gcaggtt |
237 |
Q |
| |
|
||||||| |
|
|
| T |
45075674 |
gcaggtt |
45075668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University