View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_77 (Length: 268)
Name: NF1863_low_77
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_77 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 79 - 268
Target Start/End: Complemental strand, 3952620 - 3952431
Alignment:
| Q |
79 |
gatgtacagaatttgtgagtggttagtaaatgatggagcaaagaaatgaaagtgatatgcttcaacattggagaaaaggatcatggcaatggcaagggtt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3952620 |
gatgtacagaatttgtgagtggttagtaaatgatggagcaaagaaatgaaagtgatatgtttcaacattggagaaaaggatcatggcaatggcaagggtt |
3952521 |
T |
|
| Q |
179 |
agagttagaggatatgaaagaaaatgatgaactaaacaaattaatgttgtctttgccagaaattcctgagccaccaacacctcttgagcc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3952520 |
agagttagaggatatgaaagaaaatgatgaactaaacaaattaatgttgtctttgccagaaattcctgagccaccaacacctcttgagcc |
3952431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University