View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1863_low_92 (Length: 247)
Name: NF1863_low_92
Description: NF1863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1863_low_92 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 45636525 - 45636291
Alignment:
| Q |
13 |
aaaatgcagagaaatcttagaggatccgctnnnnnnngagttttttcatttgcaaaacgacctaacaaaattcgaaagaactaattcttctaaagtcctt |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45636525 |
aaaatgcagagaaatcgtagaggatccgctaaaaaaagagttttttcatttgcaaaacgacctaacaaaattcgaaagaactaattcttctaaagtcctt |
45636426 |
T |
 |
| Q |
113 |
ttcatgttgagaatctacttatttgaaaagatgatcaaatcatttgatttgttggtcacaagttggcaagtgttaaggcaagagaaagagataaaggttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45636425 |
ttcatgttgagaatctacttatttgaaaagatgatcaaatcatttgatttgttggtcacaagttggcaagtgttaaggcaagagaaagagataaaggttt |
45636326 |
T |
 |
| Q |
213 |
gtttaaagggaaacttgagagaatggacagaaaaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45636325 |
gtttaaagggaaacttgagagaatggacagaaaaa |
45636291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University