View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18641_low_10 (Length: 232)
Name: NF18641_low_10
Description: NF18641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18641_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 27 - 217
Target Start/End: Complemental strand, 25331116 - 25330926
Alignment:
| Q |
27 |
aatttcattgtccactaacgaagtccaataaatagttcttttaatcattagagcttagagtttaagaattttcaataaattgagtattgattgtatcatt |
126 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25331116 |
aatttcactgtccactaacgaagttcaataaatagttcttttaatcattagagtttagagcttaagaattttcaataaattgagttttgattgtatcatt |
25331017 |
T |
|
| Q |
127 |
tgaataattctaaatgtgttttatctaatgaaaattttannnnnnnagacacatataatagattagagtaacattgtttgactgagtatta |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25331016 |
tagataattctaaatgtgttttatctaatgaaaattttatttttttagacacatataatagattagagtaacattgtttgactgagtatta |
25330926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University