View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18642_low_20 (Length: 245)
Name: NF18642_low_20
Description: NF18642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18642_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 28152448 - 28152672
Alignment:
| Q |
1 |
tgagtgattatcgttaggtttcttgtcaaataagctaattaatgagtacgtcttaaattattatataagtgaaaataagtaattttgacatttatcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28152448 |
tgagtgattatcgttaggtttcttgtcaaataagctaattaatgagtacgtcttaaattattatataagtgaaaataagtaattttgacatttatcaaca |
28152547 |
T |
 |
| Q |
101 |
tccaaatttatgttggttgtgtgttcagcatatactaccnnnnnnnnnccaatcttcatatagagtgatttaggggctcttgccaccccaaagaccagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28152548 |
tccaaatttatgttggttgtgtgttcagcatatactacc--tttttttccaatcttcatat--agtgatttaggggctcttgccaccccaaagaccagat |
28152643 |
T |
 |
| Q |
201 |
ttttataacacacatcacatgagatattt |
229 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
28152644 |
ttttataacacacatcacatgaaatattt |
28152672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University