View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18642_low_22 (Length: 244)
Name: NF18642_low_22
Description: NF18642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18642_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 449859 - 449632
Alignment:
| Q |
1 |
gaacataacaggctttcgatttttctcagttgtgacgattacaaaaggttgttcctcctgacacaaggcaacaccaaacttacagtcagtacgggtagtc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
449859 |
gaacataacaggcttttgatttttctcagttgtgacgattacaaaaggttgttcctcctgacacgaggcaacaccaaacttacagtcagtacgggtattc |
449760 |
T |
|
| Q |
101 |
tgactattttgaggcaaggtgctctgatggaagtagaacatgtgtccaatatggagtacggagagtttgttgaagtcaagcacattaccatcgaaatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449759 |
tgactattttgaggcaaggtgctccgatggaagtagaacatgtgtccaatatgaagtacggagagtttgttgaagtcaagcacattaccatcgaaatgtg |
449660 |
T |
|
| Q |
201 |
atgataaaggttcgttacgtaatgagaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
449659 |
atgataaaggttcgttacgtaatgagaa |
449632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University