View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18643_high_15 (Length: 295)
Name: NF18643_high_15
Description: NF18643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18643_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 6370852 - 6370586
Alignment:
| Q |
20 |
ctgagtttgttccgtcaagtgggaaggaaaaaactaggaagatggattatgtaagatatggtggtcattttttgattggaattaggggtcctagagagga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6370852 |
ctgagtttgttccgtcaagtgggaaggaaaaaactaggaagatggattatataagatatggtggtcattttttgattggaattaggggtcctagagagga |
6370753 |
T |
 |
| Q |
120 |
tgctgttgaaattaggaagaaaattgttgagttttgtgagaatacttttgggttaaggttagataattccaagttggagattgaacatattgcaaggggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6370752 |
tgctgttgaaattaggaagaaaattgttgagttttgtgagaatacttttgggttaaggttagataattccaagttggagattgaacatattgcaaggggt |
6370653 |
T |
 |
| Q |
220 |
attcaattcttggatcatataatatgcagaagggtgatacatccaactttgaggtacacaggttctg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6370652 |
attcaattcttggatcatataatatgcagaagggtgatacatccaactttgaggtatacaggttctg |
6370586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University