View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18643_high_23 (Length: 237)
Name: NF18643_high_23
Description: NF18643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18643_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 56 - 220
Target Start/End: Original strand, 31089398 - 31089562
Alignment:
| Q |
56 |
aacgtttagatgatgaagtttcttctgttgtaactttcctttagatgtttgactttctgttcagctgtttggtataccaaaagaaatcccacatcgaata |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31089398 |
aacgtttagatgatgaagtttcttctgttgtaactttcctttagatgtttgactttctgttcagctgtttggtataccaaaagaaatcccacatcgaata |
31089497 |
T |
|
| Q |
156 |
tgtgtaaaaaacagacattgagatttgcttataaaataacagtatatatcattttcaagcatatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31089498 |
tgtgtaaaaaacagacattgagatttgcttataaaataacagtatatatcatttacaagcatatt |
31089562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University