View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18643_high_26 (Length: 222)
Name: NF18643_high_26
Description: NF18643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18643_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 63 - 207
Target Start/End: Complemental strand, 45569774 - 45569630
Alignment:
| Q |
63 |
agatagtgtgaagtccactggcttctgctttttatgtaatagttcgctgcataaattacttgctggtagtaggatgtggaaatttgggagcaatcaatga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45569774 |
agatagtgtgaagtccactggcttctgctttttatgtaatagttcgctgcataaattacttgctggtagtaggatgtggaaatttgggagcaatcaatga |
45569675 |
T |
|
| Q |
163 |
tagcaaaggtgttgttgtcatttcttggaaggggatcctcatatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45569674 |
tagcaaaggtgttgttgtcatttcttggaaggggatcctcatatt |
45569630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 82 - 149
Target Start/End: Original strand, 45175587 - 45175653
Alignment:
| Q |
82 |
ggcttctgctttttatgtaatagttcgctgcataaattacttgctggtagtaggatgtggaaatttgg |
149 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||| |||||||||| |||||| || | ||||||||||| |
|
|
| T |
45175587 |
ggctgctgctttttgtgtaatagatcgctgcat-aattacttgcgggtagttgggtttggaaatttgg |
45175653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 82 - 149
Target Start/End: Complemental strand, 9798216 - 9798150
Alignment:
| Q |
82 |
ggcttctgctttttatgtaatagttcgctgcataaattacttgctggtagtaggatgtggaaatttgg |
149 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||| |||||||||| |||||| || | ||||||||||| |
|
|
| T |
9798216 |
ggctgctgctttttgtgtaatagatcgctgcat-aattacttgcgggtagttgggtttggaaatttgg |
9798150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University