View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18643_high_28 (Length: 203)

Name: NF18643_high_28
Description: NF18643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18643_high_28
NF18643_high_28
[»] chr4 (1 HSPs)
chr4 (17-104)||(7168205-7168292)


Alignment Details
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 17 - 104
Target Start/End: Complemental strand, 7168292 - 7168205
Alignment:
17 aatatacggagtatgagtgagtataaatgaaattaaagctatgataattaattnnnnnnnttatttaccatgaccacaaacttcctct 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
7168292 aatatacggagtatgagtgagtataaatgaaattaaagctatgataattaattaaaaaaattatttaccatgaccacaaacttcctct 7168205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University