View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18643_low_15 (Length: 316)
Name: NF18643_low_15
Description: NF18643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18643_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 109 - 299
Target Start/End: Complemental strand, 11310301 - 11310111
Alignment:
| Q |
109 |
atcaaaagttaaaaatatttactttattttatgaagttaagttgtttgtttaggaagagttaaattattcatctgtttaatttgagccacacaacaaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11310301 |
atcaaaagttaaaaatatttactttattttatgaagttaagttgtttgtttaggaagagttaaattattcatctgtttaatttgagccacacaacaaatt |
11310202 |
T |
 |
| Q |
209 |
accattagctgtcccttgatgaaatggttgaatctacctagtacccagttagctcaagccgcaagttcaagtattgtaatgaatgggaact |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11310201 |
accattagctgtcccttgatgaaatggttgaatctacctagtacctagctagctcaagccgcaagttcaagtattgtaatgaatgggaact |
11310111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University