View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18643_low_29 (Length: 237)
Name: NF18643_low_29
Description: NF18643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18643_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 13203109 - 13202995
Alignment:
| Q |
104 |
aggacagttgttatctaatgtctcatcaattatctaagtgccacaaatttctttgataaagttgcatgcatcttatccacgttgacggtttgccaaagtt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13203109 |
aggacagttgttatctaatgtctcatcaattatctaagtgccacaaatttctttgataatgttgcatgcatcttatccacgttgacggtttgccaaagtt |
13203010 |
T |
|
| Q |
204 |
acatttccgcgtttc |
218 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13203009 |
acatttccgcgtttc |
13202995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University