View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_high_19 (Length: 244)
Name: NF18644_high_19
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 3 - 228
Target Start/End: Complemental strand, 38178259 - 38178034
Alignment:
| Q |
3 |
tttgaattttactgcagtttatcctgtacattttatgataccttgaaattttgattttgattgttattagtattactgttagataattagattttgatga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38178259 |
tttgaattttactgcagtttatcctgtacattttatgataccttgcaattttgattttgattgttattagtattactgttagataattagattttgatga |
38178160 |
T |
 |
| Q |
103 |
atattagatgattaaataatgattggcaaataggagagaacataatttatttgatgtcttttatagacagaatagaatatattagaatagaccagggtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38178159 |
atattagatgattaaataatgattggcaaataggagagaacataatttatttgatgtcttttatagacagaatagaatatattagaatagaccagggtag |
38178060 |
T |
 |
| Q |
203 |
ataaattttgtagataactgtgttag |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38178059 |
ataaattttgtagataactgtgttag |
38178034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University