View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_high_9 (Length: 316)
Name: NF18644_high_9
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 4 - 300
Target Start/End: Original strand, 33716230 - 33716526
Alignment:
| Q |
4 |
attcttctgacagggggcagttaaattgaggaagcttgacctgcagtacttgtctcttccaaaacatgtttgccaaatttcacctgggccaaattatgac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33716230 |
attcttctgacagggggcagttaaattgaggaagcttgacctgcagtacttgtctcttccaaaacatgtttgccaaatttcacctgggccaaattatgac |
33716329 |
T |
 |
| Q |
104 |
tttttctcatcagtcatgcgctttataatatcatctcctgtggtatgtgaatggttgctgcttctttttctcttgagaatatgaaaatgaaagaatgttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33716330 |
tttttctcatcagtcatgcgctttataatatcatctcctgtggtatgtgaatggttgctgcttctttttctcttgagaatatgaaaatgaaagaatgttt |
33716429 |
T |
 |
| Q |
204 |
taagataaatttggttttgagtatttgtttgattttagctcaagaatgatgttgcaagatgaatttcaaaatagaactttggcgaacatttagatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33716430 |
taagataaatttggttttgagtatttgtttgattttagctcaagaatgatgttgcaagatgaatttcaaaatagaactttggtgaacatttagatat |
33716526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University