View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_low_10 (Length: 335)
Name: NF18644_low_10
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 49 - 323
Target Start/End: Original strand, 47826978 - 47827252
Alignment:
| Q |
49 |
gtaggataacaacaaagaacttagaacggtccaaaacaaaagggacaagaaattactgacatttttctttcatttgcagctttcatttgaccttcttgaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47826978 |
gtaggataacaacaaagaacttagaacggtccaaaacaaaagggacaagaaattactgacatatttctttcatttgcagctttcatttgaccttcttgaa |
47827077 |
T |
 |
| Q |
149 |
tcatggatccaaagaaattctgatgcagtggagatgaagaaattagatggggcatccgtctttaaagaactcgctctattccaggattatcacggcttac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47827078 |
tcatggatccaaagaaattctgatgcagtggagatgaagaaattagatggggcatcagtctttaaagaactcgctctattccaggattatcacggcttac |
47827177 |
T |
 |
| Q |
249 |
ctactttcaaaaatgtaagacatatatactctcttataagataaatttaattagttgtacatgttgacatgatga |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47827178 |
ctactttcaaaaatgtaagacatatatactctcttataagataaatttaattagttgtacatgttgacatgatga |
47827252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University