View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_low_13 (Length: 290)
Name: NF18644_low_13
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 2486819 - 2486665
Alignment:
| Q |
18 |
atgaacaggggaagttttgaattagcttcaaggaatcagtagaaacataaaagcttatcaatccctgattataaactaccaaattcagactaaccggctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2486819 |
atgaacaggggaagttttgaattagcttcaaggaatcagtagaaacataaaagcttatcaatccctcattataaactaccaaattcagactaaccggctg |
2486720 |
T |
|
| Q |
118 |
gtcccgagagcagaatagtccggcttgcaggagcaagattccgtgtatatttaga |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486719 |
gtcccgagagcagaatagtccggcttgcaggagcaagattccgtgtatatttaga |
2486665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University