View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_low_21 (Length: 250)
Name: NF18644_low_21
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 33420296 - 33420529
Alignment:
| Q |
1 |
gaaaacctaccaattgtttcataggacttccggtacgatgtttttgtggtctcataaacagcaatatagggtgcctccctacaatgtttccatggttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33420296 |
gaaaacctaccaattgtttcataggacttctggttcgatgtttttgtggtctcataaacagcaatatagggtgcctccctacaatgtttccatggttttt |
33420395 |
T |
 |
| Q |
101 |
aactccaacagtgactgagaccgacatgcttttgcaggtttcttcatccaactctgaaactaatttgtaccgtatagtttctgaattttcggtcatcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33420396 |
aactccaacagtgactgagaccgacatgcttttgcaggtttcttcatccaactctgaaactaatttgtaccgtatagtttctgaattttcagtcatcaaa |
33420495 |
T |
 |
| Q |
201 |
tgagtggatgattgattgaaatgaagtttgtcat |
234 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
33420496 |
tgagtggacgattgattgaaatgaagtttgtcat |
33420529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University