View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_low_23 (Length: 243)
Name: NF18644_low_23
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 39751659 - 39751852
Alignment:
| Q |
18 |
agcaggagctgccattgtgattggtcttcaacagttaaagggactgtttggaattacacattttacaaccaaaacagacataatctctgtcttgaaagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751659 |
agcaggagctgccattgtgattggtcttcaacagttaaagggactgtttggaattacacattttacaaccaaaacagacataatctctgtcttgaaagct |
39751758 |
T |
|
| Q |
118 |
gtttgggaagcatttcataaccctgtatgctactactttttcttcgtttttactataaatagcatataaacatgttaatccaaaaactcaagtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751759 |
gtttgggaagcatttcataaccctgtatgctactactttttcttcgtttttactataaatagcatataaacatgttaatccaaaaactcaagtt |
39751852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University