View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_low_27 (Length: 222)
Name: NF18644_low_27
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 44 - 198
Target Start/End: Original strand, 33044735 - 33044889
Alignment:
| Q |
44 |
aatatctaagacaattaatacaattgatataataagagtaaagaaattttggagggtcgagcttcattggtagaagagttttcattgcagatcaatgctt |
143 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33044735 |
aatatctaagacaattagtacaattgatataataagagtaaagaaattttggagggtcgagcttcattggtagaagagttttcattgcagatcaatgctt |
33044834 |
T |
 |
| Q |
144 |
caaaacccttcaaatcatgcgaagtgtaaccgaagttctctcaaaggtaaggatc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33044835 |
caaaacccttcaaatcatgcgaagtgtaaccgaagttctctcaaaggtaaggatc |
33044889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 34882680 - 34882631
Alignment:
| Q |
124 |
ttcattgcagatcaatgcttcaaaacccttcaaatcatgcgaagtgtaacc |
174 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
34882680 |
ttcattgcagatcaatgcatcaaa-cccttcaaatcatgcaaagtgtaacc |
34882631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University