View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18644_low_29 (Length: 208)

Name: NF18644_low_29
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18644_low_29
NF18644_low_29
[»] chr8 (2 HSPs)
chr8 (44-192)||(1966802-1966950)
chr8 (51-192)||(2009927-2010068)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 44 - 192
Target Start/End: Original strand, 1966802 - 1966950
Alignment:
44 gagccgtttccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcg 143  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1966802 gagccgattccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcg 1966901  T
144 gcatcattgattatatttcatctttcggttgggcgcgataactagtttc 192  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||    
1966902 gcatcattgattatatttcatctttcggttggacgcgataactagtttc 1966950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 51 - 192
Target Start/End: Complemental strand, 2010068 - 2009927
Alignment:
51 ttccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcggcatcat 150  Q
    ||||||||||||| ||||  ||||| |||||| |||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||    
2010068 ttccagagcagccgaactcagtctagttgaatatttggtagctgtaactggggctatttagccgttttggtgtcaaaacatattgattattcggaatcat 2009969  T
151 tgattatatttcatctttcggttgggcgcgataactagtttc 192  Q
    |||||||||||||||||| ||||||||| |||||||| ||||    
2009968 tgattatatttcatctttaggttgggcgtgataactaatttc 2009927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University