View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18644_low_29 (Length: 208)
Name: NF18644_low_29
Description: NF18644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18644_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 44 - 192
Target Start/End: Original strand, 1966802 - 1966950
Alignment:
| Q |
44 |
gagccgtttccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcg |
143 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1966802 |
gagccgattccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcg |
1966901 |
T |
 |
| Q |
144 |
gcatcattgattatatttcatctttcggttgggcgcgataactagtttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1966902 |
gcatcattgattatatttcatctttcggttggacgcgataactagtttc |
1966950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 51 - 192
Target Start/End: Complemental strand, 2010068 - 2009927
Alignment:
| Q |
51 |
ttccagagcagccaaacttggtctaattgaatctttgttagctgtaactggggctatttagccgttttgatgtcaaaacacattgattattcggcatcat |
150 |
Q |
| |
|
||||||||||||| |||| ||||| |||||| |||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
2010068 |
ttccagagcagccgaactcagtctagttgaatatttggtagctgtaactggggctatttagccgttttggtgtcaaaacatattgattattcggaatcat |
2009969 |
T |
 |
| Q |
151 |
tgattatatttcatctttcggttgggcgcgataactagtttc |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
2009968 |
tgattatatttcatctttaggttgggcgtgataactaatttc |
2009927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University