View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_high_24 (Length: 222)
Name: NF18645_high_24
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 95 - 204
Target Start/End: Original strand, 20119363 - 20119472
Alignment:
| Q |
95 |
gatgattatggaatgtggaatagtattgactcaaattatgttttcgtgctatagctgttatttacaagtcttttaagccacatgattaccatcttttttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20119363 |
gatgattatggaatgtggaatagtattgactcaaattatgtttttgtgctatagctgttatttacaagtcttttaagtcacatgattaccatcttttttg |
20119462 |
T |
 |
| Q |
195 |
gcaaattatg |
204 |
Q |
| |
|
|||||||||| |
|
|
| T |
20119463 |
gcaaattatg |
20119472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University