View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_high_26 (Length: 205)
Name: NF18645_high_26
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 58 - 182
Target Start/End: Complemental strand, 6082113 - 6081989
Alignment:
| Q |
58 |
ttccatacttacatgaccttctaagaatgaagttgaagattcataagtttaggtgcaagaaatggttagttagaacatagaagttgagaaagtaaagaga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6082113 |
ttccatacttacatgaccttctaagaatgaagttgaaggttgataagtttaggtgcaagaaatggttagttagaacatagaagttgagaaagtgaagaga |
6082014 |
T |
 |
| Q |
158 |
acaatgaatatgataacgtgttgtg |
182 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6082013 |
acaatgaatatgataacgtgttgtg |
6081989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University