View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_low_15 (Length: 340)
Name: NF18645_low_15
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] scaffold0055 (9 HSPs) |
 |  |  |
|
| [»] scaffold0052 (9 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 86 - 340
Target Start/End: Complemental strand, 3424636 - 3424383
Alignment:
| Q |
86 |
gacctttcatcggaatcaaatcggtccaaattcaaatttgttattgtgaaattattgtaaaataaaaatttataattttttgaatcggtccaatcttaat |
185 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3424636 |
gacctttcatctgaatcaaattggtccaaattcaaatttgttattgtgaaattattgtaaaataaaaatttataattttttgaatcg-tccaatcttaat |
3424538 |
T |
 |
| Q |
186 |
cggatagaaccaatgtcgagcagaaatctgaatcaaatgaaaagataccaatccatgaacatcaaaacctcactgtttagggatgatgaggctattattt |
285 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3424537 |
cggatagaaccaatgtcgagcggaaatctgaatcgaatgaaaagataccaatccatgaacatcaacacctcactgtttagggatgatgaggctattattt |
3424438 |
T |
 |
| Q |
286 |
gtcaggtcactgctggaaaattcgggatcttgcagcaagcctcaaaaccaacctc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3424437 |
gtcaggtcactgctggaaaattcgggatcttgcagcaagcctaaaaaccaacctc |
3424383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055 (Bit Score: 53; Significance: 2e-21; HSPs: 9)
Name: scaffold0055
Description:
Target: scaffold0055; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 14994 - 15070
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14994 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
15070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 40164 - 40088
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40164 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
40088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 49412 - 49336
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49412 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
49336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 65035 - 64959
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
65035 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
64959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 73222 - 73298
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
73222 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
73298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 26524 - 26600
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || |||||||||| |||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26524 |
agatgaaaaggactttgaaaagagagttaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
26600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 31069 - 30993
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31069 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccgacgatg |
30993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 60726 - 60650
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
60726 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccgacgatg |
60650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 5857 - 5933
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || |||||||| |||||||| || || ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5857 |
agatgaaaaggactttgaaaagagactcaaagagtgcttgaaattgtcgggagggaagcagatgggggccggcgatg |
5933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052 (Bit Score: 53; Significance: 2e-21; HSPs: 9)
Name: scaffold0052
Description:
Target: scaffold0052; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 15122 - 15046
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15122 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
15046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 23937 - 23861
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23937 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
23861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 32039 - 32115
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32039 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
32115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 36893 - 36969
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36893 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
36969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 46319 - 46243
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46319 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccgacgatg |
46243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 14 - 86
Target Start/End: Complemental strand, 61006 - 60934
Alignment:
| Q |
14 |
gaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
61006 |
gaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
60934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 64996 - 65072
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
64996 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccgacgatg |
65072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 69541 - 69465
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || |||||||||| |||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
69541 |
agatgaaaaggactttgaaaagagagttaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
69465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 78678 - 78602
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || |||||||| |||||||| || || ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
78678 |
agatgaaaaggactttgaaaagagactcaaagagtgcttgaaattgtcgggagggaagcagatgggggccggcgatg |
78602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 61543 - 61467
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
61543 |
agatgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgccgggagggaagcggatgggggccggcgatg |
61467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 89432 - 89361
Alignment:
| Q |
12 |
atgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcg |
83 |
Q |
| |
|
||||||||||| || ||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
89432 |
atgaaaaggactttgaaaagagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcg |
89361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 26 - 86
Target Start/End: Complemental strand, 12592085 - 12592025
Alignment:
| Q |
26 |
aaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggggccggcgatg |
86 |
Q |
| |
|
|||| ||||||||||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12592085 |
aaaatgagagtcaaagagtgcttgaaattgtcgggagggaagcggatgggggccggcgatg |
12592025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 76
Target Start/End: Original strand, 5028154 - 5028220
Alignment:
| Q |
10 |
agatgaaaaggacgttaaaaagagagtcaaagaggactcgacattgtcgggagggaagcggatgggg |
76 |
Q |
| |
|
||||||||| ||| || |||||||||||| |||| || || ||||| ||||||||||||||||||| |
|
|
| T |
5028154 |
agatgaaaatgactttgaaaagagagtcagagagttcttgaaattgttgggagggaagcggatgggg |
5028220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University