View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_low_17 (Length: 330)
Name: NF18645_low_17
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 40023377 - 40023070
Alignment:
| Q |
1 |
acataggctaccatcgatcatattttggtgacaaaggggagctagggttacgacgacacacatgaaccaaaatgtgtgctaataataatcaggcttctag |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
40023377 |
acataggctaccatcgatc-tattttggtgacaaaggggagctagggttacgacgacacacatgaaccaaaatgtgtcctaataat---caggcttctag |
40023282 |
T |
|
| Q |
101 |
ttgagacattaatgaatgcttggacatcgtgtaggtttatcattgctttaacaaaaaatggaag----tatcaggatctatgtaaacaaccatggccacg |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
40023281 |
tcgagacattaatgaatgcttggacatcgtgtaggtttgtcattgctttaactgaaaatggaagggagtatcaggatctatgtaaacaaccatggccatg |
40023182 |
T |
|
| Q |
197 |
taagggtgagaagttacacttaagaatgggtattgagatggaggagaagccggtggaaaacacttgcaatgggggtaataataagaaacatctagccatc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023181 |
taagggtgagaagttacacttaagaatgggtattgagatggaggagaagccggtggaaaacacttgcaatgggggtaataataagaaacatctagccatc |
40023082 |
T |
|
| Q |
297 |
gcggtgaaacat |
308 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40023081 |
gcggtgaaacat |
40023070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University