View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18645_low_21 (Length: 306)

Name: NF18645_low_21
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18645_low_21
NF18645_low_21
[»] chr3 (2 HSPs)
chr3 (194-298)||(34846688-34846792)
chr3 (17-77)||(34846634-34846694)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 194 - 298
Target Start/End: Original strand, 34846688 - 34846792
Alignment:
194 gttgttttttagtttggtaaacaaataaacaaatcaaatcaaatatacttttcacaactacttaattgtgtcacttccctaaactcatagacggtacttc 293  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34846688 gttgttttttagtctggtaaacaaataaacaaatcaaatcaaatatacttttcacaactacttaattgtgtcacttccctaaactcatagacggtacttc 34846787  T
294 atctc 298  Q
     ||||    
34846788 ttctc 34846792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 34846634 - 34846694
Alignment:
17 agaaaatgcagaggaaagttgtagaaacttacgagagagaaagaattgaaagtagttgttt 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34846634 agaaaatgcagaggaaagttgtagaaacttacgagagagaaagaattgaaagtagttgttt 34846694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University