View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_low_21 (Length: 306)
Name: NF18645_low_21
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 194 - 298
Target Start/End: Original strand, 34846688 - 34846792
Alignment:
| Q |
194 |
gttgttttttagtttggtaaacaaataaacaaatcaaatcaaatatacttttcacaactacttaattgtgtcacttccctaaactcatagacggtacttc |
293 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34846688 |
gttgttttttagtctggtaaacaaataaacaaatcaaatcaaatatacttttcacaactacttaattgtgtcacttccctaaactcatagacggtacttc |
34846787 |
T |
 |
| Q |
294 |
atctc |
298 |
Q |
| |
|
|||| |
|
|
| T |
34846788 |
ttctc |
34846792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 34846634 - 34846694
Alignment:
| Q |
17 |
agaaaatgcagaggaaagttgtagaaacttacgagagagaaagaattgaaagtagttgttt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34846634 |
agaaaatgcagaggaaagttgtagaaacttacgagagagaaagaattgaaagtagttgttt |
34846694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University