View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_low_23 (Length: 277)
Name: NF18645_low_23
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 39846491 - 39846242
Alignment:
| Q |
1 |
acgtacatggtctagccagtgcaattagccagagacatatatagagtaggctttaccatcaattaactctgttcatgcttcattgttagtttcaaacttt |
100 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39846491 |
acgtacatggtgtagctagtgcaattagccagagacatatatagagtag---------tcaattaactctgttcatgcttcattgttactttcaaacttt |
39846401 |
T |
 |
| Q |
101 |
attaaagttatgaaatattataatttacacaaatcaattaattatttgacagcaatttaattaacttcaatggaccaacaacattggttggctgggctgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
39846400 |
attaaagttatgaaatattataatttacacaaaacaattaattatttgaccgcaatttaattaacttcaatggaccaacaacattggttggccgggcagt |
39846301 |
T |
 |
| Q |
201 |
tttaccccagttagtctgggcacatgtccagactcaacccataagaaacttgacctgtg |
259 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39846300 |
tttaccccagctagtctggacacatgtccagactcaacccataagaaacttgacatgtg |
39846242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University