View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18645_low_26 (Length: 239)
Name: NF18645_low_26
Description: NF18645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18645_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3424336 - 3424117
Alignment:
| Q |
1 |
ttcactcatttaagcccccacaaactcaaatttcaccctttcacttttgaaaaaaccacctttctcgtaacaaacaacaacagcaaaattgtgaaaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||| |
|
|
| T |
3424336 |
ttcactcatttaagcccccacaaactcaaatttcaccctttcacttttgaaaaaaccacctttctcgtaacaa----caacagcaacatagtgaaaaaag |
3424241 |
T |
 |
| Q |
101 |
ccgtaaactgaaatccaaactctctt---ctttgccttcatgggtggtaccgtttctactcctcaaacagacaaatttccgttggatacaacggaatcca |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424240 |
ccgtaaactgaaatccaaactctctttgtctttgccttcatgggtggtaccgtttctactcctcaaacagacaaatttccgttggatacaacggaatcca |
3424141 |
T |
 |
| Q |
198 |
atgactctcttcttaggccatcga |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3424140 |
atgactctcttcttaggccatcga |
3424117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University