View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18646_low_5 (Length: 271)
Name: NF18646_low_5
Description: NF18646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18646_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 27926222 - 27926459
Alignment:
| Q |
18 |
gaaccagtctcctccttctagggttttggaatctctctattccattgatattgcctcttcaaattctcaatcccacgagtttctcagttccggtaaaact |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27926222 |
gaaccagtttcctccttctagggttttggaatctctccattccaatgatattgcctcttcaaattctcaatcccacgagtttctcagttccggtaaaact |
27926321 |
T |
 |
| Q |
118 |
attttctattcattttttccattgctcaaaaatttacacagttaagatctaagagcctgatgatcctattgttgatttaatttactgatgttgaaattct |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27926322 |
attttctattcattctttccattgctcaaaaatttacacagttaagatctaagagcctgatgatcctattgttgatttaatttactgatgttgaaattct |
27926421 |
T |
 |
| Q |
218 |
gtgtaattaagatcaatgttttcaatcatggatggaaa |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27926422 |
gtgtaattaagatcaatgttttcaatcatggatggaaa |
27926459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University