View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18647_high_16 (Length: 229)
Name: NF18647_high_16
Description: NF18647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18647_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 10337351 - 10337148
Alignment:
| Q |
18 |
gtgatatgaggtgatgattgagaacttaaagaagttaagaagttccttttaacttaacaccttaatgtgtagtgaggagaagcacataaatatatagcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337351 |
gtgatatgaggtgatgattgagaacttaaagaagttaagaagttccttttaacttaacaccttaatgtgtagtgaggagaagcacataaatatatagcct |
10337252 |
T |
|
| Q |
118 |
tctttggacggtggagtccaccnnnnnnncccaaaaattattctagcacaagttttaaatagcggtccgaccacgatatttatatcacatgtaatattct |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10337251 |
tctttggacggtggagtccacctttttttcccaaaaattattctagcacaagttttaaatagcggtccgaccacgatatttatatcacatgtaattttcg |
10337152 |
T |
|
| Q |
218 |
tcga |
221 |
Q |
| |
|
|||| |
|
|
| T |
10337151 |
tcga |
10337148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University