View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18647_low_20 (Length: 211)
Name: NF18647_low_20
Description: NF18647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18647_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 11 - 193
Target Start/End: Complemental strand, 45185820 - 45185633
Alignment:
| Q |
11 |
atcatcatggagaaagaaggggttcgtttaaactcaattcattacttttaatattgcatttcatttannnnnnn----atgtttcattacaatttcagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45185820 |
atcatcatggagaaagaaggggttcgtttaaactcaattcattacttttaatattgcatttcatttttttttttttttatgtttcattacaatttcagaa |
45185721 |
T |
|
| Q |
107 |
ttttgatt-acttgtttaacaaattgcatttataccatatttcattacatctatgtcattgttgttgtgcatttggctagtatactag |
193 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45185720 |
ttttgatttacttgtttaacaaattgcatttataccatatttcattacatctatgtcattgttgttgtgcatttggctagtatactag |
45185633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University