View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18648_low_22 (Length: 222)

Name: NF18648_low_22
Description: NF18648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18648_low_22
NF18648_low_22
[»] chr7 (1 HSPs)
chr7 (1-117)||(48570500-48570616)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 48570616 - 48570500
Alignment:
1 ttgtatgacatttgctctctagggcttttctttgaaccaaaacttgatttttatcagagcctcttacttgtggtgattctaccttgatcttatcattccg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48570616 ttgtatgacatttgctctctagggcttttctttgaaccaaaacttgatttttatcagagcctcttacttgtggtgattctaccttgatcttatcattccg 48570517  T
101 ttatggatgatgtccat 117  Q
    |||||||| ||| ||||    
48570516 ttatggattatggccat 48570500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University