View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18648_low_22 (Length: 222)
Name: NF18648_low_22
Description: NF18648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18648_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 48570616 - 48570500
Alignment:
| Q |
1 |
ttgtatgacatttgctctctagggcttttctttgaaccaaaacttgatttttatcagagcctcttacttgtggtgattctaccttgatcttatcattccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570616 |
ttgtatgacatttgctctctagggcttttctttgaaccaaaacttgatttttatcagagcctcttacttgtggtgattctaccttgatcttatcattccg |
48570517 |
T |
 |
| Q |
101 |
ttatggatgatgtccat |
117 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
48570516 |
ttatggattatggccat |
48570500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University