View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_high_18 (Length: 407)
Name: NF18649_high_18
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 23 - 398
Target Start/End: Complemental strand, 48758633 - 48758259
Alignment:
| Q |
23 |
ggaggtgttatgtgaaagggg-ataagttgattacttgttttgtttcagtacaattcaattctac-tagtgtggtgggacagggatatctgaagaatggc |
120 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48758633 |
ggaggtgttatgtgaaagggggataagttgattacttgttttgtttcagtacaattcaattctacctagtgtggtgggacagggatatctgaagaatggc |
48758534 |
T |
 |
| Q |
121 |
gaattggaggtcgacacgtggatttggattagctaaagtgtaaagagatgaattgaagtgcaacagtgttgttgaaggttgcaaaggcgtgaaggagacg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48758533 |
gaattggaggtcgacacgtggatttggattagctaaagtgtaaagagatgaattgaagtgcaacagtgttg---aaggttgcaaaggcgtgaaggagacg |
48758437 |
T |
 |
| Q |
221 |
atgactttttggaccgtttggtagcaagtttcaattccaatgcaatgtcttatttctaactggaccccgctgcatcgcttaagctaggcttgataataac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48758436 |
atgactttttggaccgtttggtagcaagtttcaattccaatgcaatgtcttatttctaactggaccccgctgcatcgcttaagctaggcttgataacaac |
48758337 |
T |
 |
| Q |
321 |
acttgatattgtcttacccgtaaccttctcttttacgctttcaattttcatttgtaaaattgtctagtgtactatatt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48758336 |
acttgatattgtcttacccgtaaccttctcttttacgctttcaattttcatttgtaaaattgtctagtgtactatatt |
48758259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University