View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_high_27 (Length: 278)
Name: NF18649_high_27
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_high_27 |
 |  |
|
| [»] scaffold0257 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 91 - 254
Target Start/End: Complemental strand, 8021928 - 8021765
Alignment:
| Q |
91 |
ttcataggttctcttaattagattaattaccgctaaaactttgtatctataacttgtcaattgttttgaacagctaaatgaatttattaatgaggaacgt |
190 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8021928 |
ttcataggttctcttacttagattaattatcgctaaaactttgtatttataacttgtcaattgttttgaacagctaaatgaatttattaatgaggaacgt |
8021829 |
T |
 |
| Q |
191 |
atgtccgagcaataaataaaatattgaaggataaagaaaagcagggaacaacttgaatgcaacg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8021828 |
atgtccgagcaataaataaaatattgaaggataaagaaaagcagggaacaaattgaatgcaacg |
8021765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 8022046 - 8021974
Alignment:
| Q |
13 |
aatattttgtcaaagtggtaaggggtgtaaatcttttaagcatgtggtaataggtttgaactctgccaccttc |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022046 |
aatattttgtcaaagtggtaaggggtgtaaatcttttaagcatgtggtaataggtttgaactctgccaccttc |
8021974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0257 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 189 - 254
Target Start/End: Complemental strand, 20094 - 20029
Alignment:
| Q |
189 |
gtatgtccgagcaataaataaaatattgaaggataaagaaaagcagggaacaacttgaatgcaacg |
254 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| |||||||| || |||||||||| |
|
|
| T |
20094 |
gtatgttcgagcaataaataaaatattcaaggataaagaaaatcagggaactgctagaatgcaacg |
20029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University