View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_high_43 (Length: 209)
Name: NF18649_high_43
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 10592683 - 10592869
Alignment:
| Q |
18 |
acattaaacacatcataaaccgtctaaaccttgcttgttatgccaccattcatagccgaacacatttcagattttataatctgaactcatgcccaatatt |
117 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||||||||||| | || ||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10592683 |
acattaaccacatcataaactgtccaaaccttgcttgttatgccaccgtccacagccggacacatttcagattttataatctgaactcatgtccaatatt |
10592782 |
T |
|
| Q |
118 |
ggttcatatgatataatttgaaatgtgcgcagattgcattaaaagttatgatttcatggtttggcatgttttttattatattcttcga |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||| ||||||||| |
|
|
| T |
10592783 |
ggttc-tatgatataatttgaaatgtgcgcagattgcattaaaagttatgatttcatagtttgacatattttttatttgattcttcga |
10592869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 22 - 171
Target Start/End: Complemental strand, 32120613 - 32120462
Alignment:
| Q |
22 |
taaacacatcataaaccgtctaaaccttgcttgttatgccac-cattcatagc-cgaacacatttcagattttataatctgaactcatgcccaatattgg |
119 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| ||||||| | | || || | ||| |||| | |||||||||| |||||||||| ||||||||| |
|
|
| T |
32120613 |
taaacacaccataaaccatctaaaccttgcttgtaatgccactcgtccacagttctgacagatttaatattttataatttgaactcatgtccaatattga |
32120514 |
T |
|
| Q |
120 |
ttcatatgatataatttgaaatgtgcgcagattgcattaaaagttatgattt |
171 |
Q |
| |
|
| || ||||||||||| |||||||||| ||||| |||||| ||||||||| |
|
|
| T |
32120513 |
tgcaggtgatataatttaaaatgtgcgcggattgtgttaaaaattatgattt |
32120462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University