View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_low_12 (Length: 450)
Name: NF18649_low_12
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_low_12 |
 | |
|
| [»] scaffold0280 (2 HSPs) |
| | |
|
| [»] scaffold0148 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0280 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1900 - 1675
Alignment:
| Q |
1 |
acattctacctgtagtaaaggaaacaagtgtctttgcaatgcaaagtataaatggagtggcgagcttttatgttgtatcgaaagtaagcaacaacaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1900 |
acattctacctgtagtaaaggaaacaagtgtctttgcaatgcaaagtataaatggagtggcgagcttttatgttgtatcgaaagaaagcaacaacaatct |
1801 |
T |
|
| Q |
101 |
tgtatcttcaatttttcaacaacttaatttgggtgtatccaatggcaagccgtaacattatgtccaatcaccgacaatgtgaacaataacttggttgcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1800 |
tgtatcttcaatttttcaacaacttaatttgggtgtatccaatggcaagccgtaacattatgtccaatcaccgacaatatgaacaataacttggttgcca |
1701 |
T |
|
| Q |
201 |
attataaacagtttatgagtataaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1700 |
attataaacagtttatgagtataaat |
1675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280; HSP #2
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 301 - 441
Target Start/End: Complemental strand, 1600 - 1460
Alignment:
| Q |
301 |
gttaggggtgtttaatgaattatgatatcatggtcgctgccaactgttcatatgatccctgaaattgctttgtagnnnnnnnnngggggatcgtatgacg |
400 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
1600 |
gttaggggtgttttatgaattatgatatcatggtcgctgccaactgttcatatgatccctgaattcgctttgtagtttttttttgggggatcgtatgacg |
1501 |
T |
|
| Q |
401 |
atcaacaaatgctttcgatatcaatcacaacacatattctt |
441 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
1500 |
gtcaacaaatacttttgatatcaatcacaacacattttctt |
1460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 2 - 63
Target Start/End: Complemental strand, 27053 - 26992
Alignment:
| Q |
2 |
cattctacctgtagtaaaggaaacaagtgtctttgcaatgcaaagtataaatggagtggcga |
63 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
27053 |
cattctacttgtagtaaaggaaagaggtgtctttgcaatgcaaactataactggaatggcga |
26992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 371
Target Start/End: Complemental strand, 5529608 - 5529551
Alignment:
| Q |
314 |
aatgaattatgatatcatggtcgctgccaactgttcatatgatccctgaaattgcttt |
371 |
Q |
| |
|
||||| ||||||||||||| || |||| ||| |||||||||||||||||||| |||| |
|
|
| T |
5529608 |
aatgatttatgatatcatgatcactgctgactattcatatgatccctgaaatttcttt |
5529551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University