View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_low_24 (Length: 347)
Name: NF18649_low_24
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 339
Target Start/End: Complemental strand, 3759159 - 3758826
Alignment:
| Q |
3 |
catcatcatcatcttcatcctcttcttcattttgattgatacacaaatcctttaataaaactaaatcgtcnnnnnnnnnnnnnnnnnngttacggctatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3759159 |
catcatcatcatcttcatcctcttcttcattttgattaatacacaaatcctttaataaaactaaatcgtccttcttcttcttctt---gttacggctatg |
3759063 |
T |
|
| Q |
103 |
gtactcattcaaaaactttctagtagcttcctccaccttagccctaccctcttccaccccacaaaaacgtaccgttttgtaatcatttctaccacaaaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
3759062 |
gtactcattcaaaaactttctagtagcttcctccaccttagctctaccctcttccactccacaaaaaccaacagttttgtaatcatttctaccacaaaat |
3758963 |
T |
|
| Q |
203 |
gacgcggttttgctcaaacaagaccgtgaaaatgaagaagcagatgaacacgtggaagctacttttccctcatgagtctcccacgtgttcatttgcttct |
302 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3758962 |
gacgctgttttgctcaaacaagaccgcgaaaacgaagaagcagatgaacacgtggaagctacttttccctcatgagtctcccacgtgttcatctgcttct |
3758863 |
T |
|
| Q |
303 |
tcgtctttgttggtttctcagtcttcgttttcttctc |
339 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3758862 |
tcgtctttgttggtttctcagtcttcattttcttctc |
3758826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University