View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_low_37 (Length: 254)
Name: NF18649_low_37
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 239
Target Start/End: Original strand, 40148353 - 40148578
Alignment:
| Q |
14 |
atatgtggcggccaaggggtggcaacatagttggaatgtcttggttcgtcatgtgttgcctttgcactcttttttgtgtaaaagaaatcatctcgtggtt |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40148353 |
atatgtggcggccaatgggtggcaacatagttggaatgtcttggttcgtcatgtgttgcctttgcactcttttctgtgtaaaagaaatcatctcgtggtt |
40148452 |
T |
|
| Q |
114 |
taaatgcttataatttattccacaattcttttgcaatgctataactaacatctaatagatgaaatttatataagccagaaaacgtgaccactttgcaaat |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40148453 |
taaatgcttatattttattccacaattcttttgcaatgctataactaacatctaatagatgaaatttatataagccagaaaacgtgaccactttgcaaat |
40148552 |
T |
|
| Q |
214 |
atatccttggtggattatgtacttta |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40148553 |
atatccttggtggattatgtacttta |
40148578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University