View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_low_47 (Length: 236)
Name: NF18649_low_47
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_low_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 7806320 - 7806556
Alignment:
| Q |
1 |
aattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatattgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7806320 |
aattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatattgattt |
7806419 |
T |
 |
| Q |
101 |
tgttagattaaaaacttttacctgagtttgaaccggtattttgcccttatttgactgaggctgatatccaactagttggaaaatttgtcattttgttaa- |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7806420 |
tgttagattaaaaacttttacctgagtttgaaccggtattttgcccttattcgactgaggctgatatccaactagttggaaaatttgtcattttgttaat |
7806519 |
T |
 |
| Q |
200 |
tgcaattggaatccaggttatcttatcttattttaat |
236 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
7806520 |
tgcaattggaatccaagttatcttatcttatcttaat |
7806556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University