View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18649_low_48 (Length: 233)
Name: NF18649_low_48
Description: NF18649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18649_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 23134415 - 23134238
Alignment:
| Q |
1 |
cacaatcaaataactacgtaaaggtaactccaccaactaccnnnnnnnntttgtttatgttaaacgcnnnnnnnttttgatacgaaaatatctgtttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
23134415 |
cacaatcaaataactacgtaaaggtaactccaccaactaccaaaaaa--tttgtttatgttaaacgcataaattttttcatacgaaaatatctgtttaaa |
23134318 |
T |
|
| Q |
101 |
taatatgacatcaaatgcaaacatattttaccggagatactaaataattatattgtatgttgaatagatacaatccaata |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23134317 |
taatatgacatcaaatgcaaacatattttaccggagatactaaataattatattgtatgttgaatagatacagtccaata |
23134238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University