View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1864_high_14 (Length: 281)
Name: NF1864_high_14
Description: NF1864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1864_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 7 - 266
Target Start/End: Complemental strand, 5022002 - 5021743
Alignment:
| Q |
7 |
ctgagatgaatactgcttcaagcaataacaaacacctctatatggtgtcagcaccccaggttttgtcgtcaaccctgcacgtgcgagaaaatactttcct |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5022002 |
ctgagttgaatactgcttcaagcaataacagacacctctatatggtgtcagcaccccaggttttgtcgtcaaccctgcacgtgcgagaaaatactttcct |
5021903 |
T |
 |
| Q |
107 |
acggaaaataaagcacacattataacttaat-catgacaatgcaattctacaaggtaatgccaactacagaccaatagtctgtcactaaccttcaggaac |
205 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5021902 |
acg-aaaataaagcacacattataacttaatacatgacaatgcaattctacaaggtaatgccaactacagaccaatagtctgtcactgaccttcaggaac |
5021804 |
T |
 |
| Q |
206 |
ttttaacggatctttccgagtaaaagcaccatctaaaactctagggtaagatgctgatcct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5021803 |
ttttaacggatctttccgagtaaaagcaccatctaaaactctagggtaagatgctgatcct |
5021743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University