View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1864_low_12 (Length: 303)
Name: NF1864_low_12
Description: NF1864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1864_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 3 - 280
Target Start/End: Original strand, 9292407 - 9292687
Alignment:
| Q |
3 |
gaagaaaatacctggtgaactccatagacnnnnnnnatgacatgacatgattttcatgtctacgaatgttcggctagtttcttaattttttattgagcct |
102 |
Q |
| |
|
|||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9292407 |
gaagaatatacctggtgaactccatagactttttttataacatgacatgattttcatgtctacgaatgttcggctaatttcttaattttttattgagcct |
9292506 |
T |
 |
| Q |
103 |
ttaacccccttt-gtatcaaaataaaaagatatgattcagtcatgttggcatcacatcccctacaaataatctgcaaacacatctcaataatactaatga |
201 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
9292507 |
ttaatccccttttgtatcaaaataaaaagatatgattcagtcatgttggcatcacatcccctaaaaataatctgcaaatacatcttaataatactaatga |
9292606 |
T |
 |
| Q |
202 |
tacaaatagaaaaaatcc--acagatatgagagcataaagtattcggccaatagaaatttaccaaatcaatagcaaggtag |
280 |
Q |
| |
|
|||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9292607 |
tacaaatagaaaaaatgcaaagagatatgagagcataaagtattcggccaatagaaatttaccaaatcaatagcaaggtag |
9292687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University