View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1864_low_13 (Length: 298)
Name: NF1864_low_13
Description: NF1864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1864_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 14 - 144
Target Start/End: Original strand, 11477732 - 11477862
Alignment:
| Q |
14 |
gaaacagaaaaagcaacggtctctataatatgtaacctttttatttgtctggtttgaatttgaaactgttactttagctaaacatcatttgaaactgttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11477732 |
gaaacagaaaaagcaacggtctctataatatgtaacctttttatttgtctggtttgaatttgaaactgttactttagctaaacatcatttgaaactgttc |
11477831 |
T |
 |
| Q |
114 |
cctccttagcttttgtgcctttattcatgcc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11477832 |
cctccttagcttttgtgcctttattcatgcc |
11477862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 249 - 282
Target Start/End: Original strand, 11477967 - 11478000
Alignment:
| Q |
249 |
tagttgaattagacatgcaaggtgtgttctatat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11477967 |
tagttgaattagacatgcaaggtgtgttctatat |
11478000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University